Red Cotton™ gRNA Plasmid Bank

location： Home > Products > Red Cotton™ gRNA Plasmid Bank >

EZ-editor™

Gene-eidting Series Products

With 15 years of experience, Ubigene has exclusively innovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

Request a quote Right Now!

EZ-editor™

Gene-editing Series Products

With 14 years of experience, Ubigene has exclusivelyinnovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

EZ-editor™ Gene-editing Series Products

CRISPR-iScreen™ Library

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID	Size	Price (USD)	Turnaround	Resistance	Product Name	Type of Plasmid	Catalog#	gRNA Sequence
3718	≥2ug	80	3-5(business day)	EGFP/puro	JAK3 gRNA1-gRNA2 KO plasmid	Lentiviral Plasmid	YKO-LV001-JAK3[gRNA1-gRNA2]	AGGGGCGTCTCTTCACTTGG AGCCTCTTGTCCACGGAGGC	Order Strategy
5553	≥2ug	80	3-5(business day)	EGFP/puro	PRG2 gRNA3-gRNA4 KO plasmid	Lentiviral Plasmid	YKO-LV001-PRG2[gRNA3-gRNA4]	GCAGCGTCTTAGCACCCAAA CAAAAACCTTACGTGTCCTG	Order Strategy
56805	≥2ug	80	3-5(business day)	EGFP/puro/cas9	Zbtb33 gRNA3-gRNA4 KO plasmid	Regular Plasmid	YKO-RP003-Zbtb33[gRNA3-gRNA4]	TCACAGGTTAAAAGCATATC CACTTCCGAAATAGCAACAG	Order Strategy
56480	≥2ug	80	3-5(business day)	EGFP/puro	Tbk1 gRNA1-gRNA2 KO plasmid	Lentiviral Plasmid	YKO-LV001-Tbk1[gRNA1-gRNA2]	CTGCAAATGTCTTCCGAGGA CCTGGCCTAGGATATCAGAC	Order Strategy
9365	≥2ug	80	3-5(business day)	EGFP/puro/cas9	hKL gRNA1 KO plasmid hKL gRNA2 KO plasmid hKL gRNA3 KO plasmid	Regular Plasmid	YKO-RP003-hKL[gRNA1] YKO-RP003-hKL[gRNA2] YKO-RP003-hKL[gRNA3]	CAACGTCTTCCGCGACACGG AGG(98,0.74) ACTTGACCTGACCGCCGAAG TGG(98,0.68) CACCACGTAGGGGTTGTCGA TGG(98,0.71)	Order Strategy
3107	≥2ug	80	3-5(business day)	EGFP/puro/cas9	hHLA-C gRNA1 KO plasmid hHLA-C gRNA2 KO plasmid hHLA-C gRNA3 KO plasmid	Regular Plasmid	YKO-RP003-hHLA-C[gRNA1] YKO-RP003-hHLA-C[gRNA2] YKO-RP003-hHLA-C[gRNA3]	ATTTCGACACCGCCGTGTCC CGG(92,0.73) GCGACGCCGCGAGTCCGAGA GGG(72,0.65) AGGCTGACCGAGTGAGCCTG CGG(66,0.71)	Order Strategy
2717	≥2ug	80	3-5(business day)	EGFP/puro/cas9	hGLA gRNA1 KO plasmid hGLA gRNA2 KO plasmid hGLA gRNA3 KO plasmid	Regular Plasmid	YKO-RP003-hGLA[gRNA1] YKO-RP003-hGLA[gRNA2] YKO-RP003-hGLA[gRNA3]	TTGGCAAGGACGCCTACCAT GGG(94,0.71) AGGAACCCAGAACTACATCT GGG(78,0.56) CATCCCTGGGGCTAGAGCAC TGG(69,0.74)	Order Strategy
100379571	≥2ug	80	3-5(business day)	EGFP/puro	BACE1-AS gRNA1-gRNA2 KO plasmid	Lentiviral Plasmid	YKO-LV001-BACE1-AS[gRNA1-gRNA2]	TCCAAGCAGGTACACTTAGG ACACAGCAGGATCTGCGGTT	Order Strategy
479432	≥2ug	80	3-5(business day)	EGFP/puro/cas9	dgCADM1 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-dgCADM1[gRNA1-gRNA2]	TCGATCATCAGATTGCGTGG TGAAGTGAACTGCACCGCCA	Order Strategy
492244	≥2ug	80	3-5(business day)	EGFP/puro/cas9	dgL1CAM gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-dgL1CAM[gRNA1-gRNA2]	TGACATCAGCCTCAAGTGTG GGGGACTGTTCCGTGATGAC	Order Strategy

1 2 3 4 5

Product Name	Price (USD)
JAK3 gRNA1-gRNA2 KO plasmid	80	Order Strategy
PRG2 gRNA3-gRNA4 KO plasmid	80	Order Strategy
Zbtb33 gRNA3-gRNA4 KO plasmid	80	Order Strategy
Tbk1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
hKL gRNA1 KO plasmid hKL gRNA2 KO plasmid hKL gRNA3 KO plasmid	80	Order Strategy
hHLA-C gRNA1 KO plasmid hHLA-C gRNA2 KO plasmid hHLA-C gRNA3 KO plasmid	80	Order Strategy
hGLA gRNA1 KO plasmid hGLA gRNA2 KO plasmid hGLA gRNA3 KO plasmid	80	Order Strategy
BACE1-AS gRNA1-gRNA2 KO plasmid	80	Order Strategy
dgCADM1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
dgL1CAM gRNA1-gRNA2 KO plasmid	80	Order Strategy

1 2 3 4 5

Subscribe Us

* E-mail：

Country/Region：

Name：

By subscription, you consent to allow Ubigene Biosciences to store and process the information provided above to deliver the latest news, research spotlight, and promotions. You can unsubscribe from these communications at anytime.